Such an exciting find! Various ages fruiting and collected as a voucher. Growing on very well decayed wood.
ID a decent fit.. But I cannot find if the hairs on the underside are consistent with this genus/species. Whatever it is - it's Somewhat common on fallen logs. Olive green to yellow tones peeking through in aged specimens, along with micro and a similar sequenced obs has me thinking this genus.
Spores:
(6.2) 7.1 - 8.7 (10.1) × (1.7) 1.75 - 2.8 (3.1) µm
Q = (2.7) 2.9 - 4.4 (5.4) ; N = 10
Me = 7.9 × 2.4 µm ; Qe = 3.5
Asci with I+ apical pore
(77.4) 78.8 - 84.9 (87.5) × (3.7) 4.3 - 5.3 (6.2) µm
Q = (12.7) 15.6 - 18.9 (20.8) ; N = 8
Me = 82.3 × 4.9 µm ; Qe = 17.3
Ag428, backyard oak tree in the La Crosse area, private property, location not reported
Ag490
Tuber sp. collected on surface of soil in flood plain. Likely washed up in the flood.
JV443
AGTCACATTCCTCAAGCCTTTATTCCACCGTCCTAACCGATGCTGGCCCAGCCAAGGGCAAGTGCACCACCCAGAAGGGAGGTTGTTCACCCAAGGCTGAGTCTGGTCTCAAGCGCTTCCCTTTCAACAATTTCACGTACTGTTTGACTCTATTTTCAAAGTGCTTTTCATCTTTCGATCACTCTACTTGTGCGCTATCGGTCTCTCGCCAATATTTAGCTTTAGATGAAATTTACCACCCATTTTGAGCTGCATTCCCAAACAACTCGACTCGTAGAAAGCACTACCGACTGAAGGGTATATCCAGCCATGAACGGGATTCTCACCCTCTGCGATGTCCTGTTCCAAGGAACATAGGCTGGACCCCTCCGGAAGATGCCTCTCCAAATTACAACTCAGACACCAGAGGCGCCAGATTTCAAATTTGAGCTTTTGCCGCTTCACTCGCCGTTACTAAGGCAATCCCTGTTGGTTTCTTTTCCTCCGCTTATTGATATGCTTAAGTTCAGCGGGTATCCCTACCTGATCCGAGGTCAACCCTATATTCGCCTTGAATGGGGGTCTTTGAAGGCCAGGCCAGAACACCACAAGGGACTAATTTATGTTTCTAAAACAGTTACCAAGTCCAGTGAGGAGGTTCATTATCCTGCCTATGCATTTCAATGGGGTGAACAGTAAGCAGTGGTTGCTACAGATCACTTCCATCAACACCATAATGGTTATGAGCGGGTTTGCAGTGACGCTCGAACAGGCATGCCCCAAGGAATACCAAGGGGTGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTAC-TTATCGCATTTCGCTGCGTTCTTCATCGATACGAGAGCCAAGAGATCCGTTGTTGAAAGTTTTAACATTTTCAAAGAATATGGCACTGGG-CCAACTCAGACAGCCAATTCGATCAATAGATTTCTATGGGACCTCTCCCAGCGGCCTGAAAAGACTGGCAACTGGGAAAGCAACATGGGTTGATACACA
Found and collected by @Brennons
Growing on Marchantia polymorpha or Conocephalum. I didn't think Marchantia had black streaks like this, but gemma cups were present on this wall of liverworts like Marchantia.
Gorgeous polypore covered in guttation,
Growing trailside on log
Flew right into the pilot house at work on the ferry. The hornet host was docile enough to be squished in a napkin.
First time finding this!
With some orange sebiculum like hyphae surrounding short spines of up to 3mm long. Growing on an upturned Ulmus americana, but seemingly from the soil, no attachment to wood visible though it's possible rhizomorphs were running to connect to rootlets.
Hydonoporia? Sarcodontia or Mycoacia?
Dimitic,
Spores remaining brown in Melzers. Strongly ornamented and warted.
(6.8) 7.4 - 8.3 (8.6) × (5.8) 6.2 - 7.5 (7.7) µm
Q = 1 - 1.25 (1.3) ; N = 30
Me = 7.8 × 6.8 µm ; Qe = 1.1
Basidia 5.8 - 6.2µm wide.
Skeletal Hyphae regularly clamped and septate, 2.1 - 4.5 µm wide.
Taste unpleasant becoming bitter. Growing on downed hardwood log among moss and Chlorencoelia. X. campanella gets applied incorrectly very widely.
R. palmatus is the name that could be applied, but sequence data indicates there is at least one other Rhodotus in the midwest. On the butt of a cut fallen tree in Carya, Ulmus, Quercus area. Same fruits as in this observation.
https://www.inaturalist.org/observations/229134949
Small, gilled pleurotoids growing on living fern, living moss, and other debris nearby.
On moss covering a large boulder.
Similar observations from same outing close by rule out X. cornu-damae and X. hypoxylon.
Found along side of a campsite in the northwoods of Wisconsin. Not much larger than Mycena haematopus. growing from ground. Charcoal-ish black top, light gills. Cluster of three.
No bigger than a pinhead -appear to have cap and stem. Found on a piece of dead wood in the Northwoods of Wisconsin.
Smells like pistachio ice cream or anise. Several growing on one aromatic stick. Mixed forest.
(22NWF - LLL)
Note serrated gills - more characteristic of N. cochleatus but specimen shape and "stipe" here fits N. suavissimus
On medium decayed hardwood log. Thick mycelial cords. Maroon staining on outer surface.
Location approximate.
Maybe multiple species in these photos…
Growing from Oak leaf litter
Super soft and fuzzy on top! Growing on an aspen log I inoculated with oysters two years ago, which has yes to produce oysters.
From culture, grown on miscellaneous herbaceous stems.
Spores often truncate.
(24.8) 27.5 - 34.2 (37.4) × (11.5) 12.1 - 13.3 (13.5) µm
Q = (2) 2.1 - 2.7 (3) ; N = 15
Me = 30.9 × 12.8 µm ; Qe = 2.4
With large guttles at the poles averaging 5um in width. Smaller guttules present.
On cones of red pine
Found growing right by old deer droppings, has a nice odor despite the droppings.
Has anyone ever seen a blushing rosette like this, or that knows if this is the correct species?
Additional specimens not added to iNat observation fields:
University of Michigan Herbarium: MICH 352156
—
Originally posted to Mushroom Observer on May 15, 2019.
Fruiting bodies developed from the plasmodium from this observation:
https://www.inaturalist.org/observations/181223812
LE F-348758. RUSSIA, Murmansk region, the vicinity of the Tietta research station,
sphagnum bog with Pinus sylvestris L., on living grass and mosses, 67.600738°N, 32.996322°E, 25 VIII 2023, leg. Filippova A.V. and Bortnikov F.M.
see description in Novozhilov et al. 2023. Diachea racemosa (Myxomycetes = Myxogastrea): a new species with cespitose sporocarps from southern Vietnam and its position within the phylogenetic clade Diachea sensu lato (Physarales) // Protistology 17(4): 189–204.
First two photos by Phil Evans (5/7/20 & 5/8/20)
Rest by Fred Rhoades (5/12/20)
Stereo view is a Right-Left stereo (cross your eyes)
Micro views first at 400X second at 1000X showing spores (6-7 um, smooth) and peridial net.
Observation is for the green fungus growing on the mushroom.
Growing on oak bark. Maybe this is not the model of this species but reflect a special feature with old specimens living here for many time, at least more than 10 years, when I first discover them. the lirelas are wider and more voluminous than usual and seem to incorporate several partial growths.
For details about a similar observation from the same place 7 years ago please see https://mushroomobserver.org/199685.
Spotted off side of the road at perhaps about 20-30 mph by Tavis. On probable deadwood (knot/hollow) of a tree I think was a living maple tree.
Smells like cinnamon on the stipe.
I have no clue what this is or if it's two fungi's in attack of the other
Growing directly from basement soil. Sawdust in area.
My first thought was oak bracket, but it’s not on oak. See the leaves in the last two photos.
This is so weird. Even the young ones are hard and curled in on themselves. Dark gills, growing on dead hardwood, probably oak or hickory, totally hardened but not dry, no deliquescence. I’ve been trying to ID these for a month.
Microscopy shows Jack-like feature in the pileipellis.
Also shows lamellar trama and spores
At base of spruce with lots of hemlock around. Tastes of radish and smells mild to strong. One part got nibbled and the damaged tissue displayed impressive fluorescence under 365nm.